Primers’ sequences used for VEGF-A SNPs assessment and VEGF-A, VEGFR-1, and VEGFR-2 expression analyses
Analysis
Forward primer 5’-3’
Reverse primer 5’-3’
Fragment length
Chromosome position
SNPs
-460T/C
TGTGCAGACGGCAGTCACCA
CCCGCTACCAGCCGACTTT
588 bp
43769749
-2578C/A
ATAAGGGCCTTAGGACACCA
GCTACTTCTCCAGGCTCACA
459 bp
43768652
-2549I/D
ATAAGGGCCTTAGGACACCA
GCTACTTCTCCAGGCTCACA
459 bp
43736418
Expression
β2M
GAGGCTATCCAGCGTACTCCA
CGGCAGGCATACTCATCTTTT
-
-
VEGF-A
AGGGCAGAATCATCACGAAGT
AGGGTCTCGATTGGATGGCA
-
-
VEGFR-1
GAAAACGCATAATCTGGGACAGT
GCGTGGTGTGCTTATTTGGA
-
-
VEGFR-2
GTGATCGGAAATGACACTGGAG
CATGTTGGTCACTAACAGAAGCA
-
-
SNPs: single nucleotide polymorphisms; VEGFR-1: vascular endothelial growth factor receptor; β2M: β2 microglobulin. -: no data
Declarations
Acknowledgments
We are grateful to Department of Thoracic Surgery staff for patient recruitment and fresh tissues collection. We also thank the General Laboratory of Pathological Anatomy physicians for anatomopathological examination.
Author contributions
YE: Conceptualization, Data curation, Writing—original draft. SH, MK, SB, and MR: Data curation, Writing—review & editing. HD and FG: Writing—review & editing. MA and ME: Conceptualization, Writing—review & editing. IC: Conceptualization, Writing—review & editing, Supervision. All authors have read and approved the final version of the manuscript.
Conflicts of interest
The authors declare that they have no conflicts of interest.
Ethical approval
The study was approved by Ethics Committee of the Ibn Rochd University Hospital (Ethical approval number: 01/20).
Consent to participate
Informed consent to participate in the study was obtained from all participants.
Consent to publication
Not applicable.
Availability of data and materials
The prospective data that support the findings of this study are available from the corresponding author (Imane Chaoui, im_chaoui@yahoo.fr) upon reasonable request.
Open Exploration maintains a neutral stance on jurisdictional claims in published institutional affiliations and maps. All opinions expressed in this article are the personal views of the author(s) and do not represent the stance of the editorial team or the publisher.
References
Bray F, Laversanne M, Sung H, Ferlay J, Siegel RL, Soerjomataram I, et al. Global cancer statistics 2022: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries.CA Cancer J Clin. 2024;74:229–63. [DOI] [PubMed]
Larsen JE, Minna JD. Molecular biology of lung cancer: clinical implications.Clin Chest Med. 2011;32:703–40. [DOI] [PubMed]
Hanahan D. Hallmarks of Cancer: New Dimensions.Cancer Discov. 2022;12:31–46. [DOI] [PubMed]
Markovic M, Mitrovic S, Dagovic A, Jovanovic D, Nikolic T, Ivosevic A, et al. Does the Expression of Vascular Endothelial Growth Factor (VEGF) and Bcl-2 Have a Prognostic Significance in Advanced Non-Small Cell Lung Cancer?Healthcare (Basel). 2023;11:292. [DOI] [PubMed] [PMC]
Patel SA, Nilsson MB, Le X, Cascone T, Jain RK, Heymach JV. Molecular Mechanisms and Future Implications of VEGF/VEGFR in Cancer Therapy.Clin Cancer Res. 2023;29:30–9. [DOI] [PubMed] [PMC]
Alevizakos M, Kaltsas S, Syrigos KN. The VEGF pathway in lung cancer.Cancer Chemother Pharmacol. 2013;72:1169–81. [DOI] [PubMed]
Frezzetti D, Gallo M, Maiello MR, D’Alessio A, Esposito C, Chicchinelli N, et al. VEGF as a potential target in lung cancer.Expert Opin Ther Targets. 2017;21:959–66. [DOI] [PubMed]
Zhao Y, Guo S, Deng J, Shen J, Du F, Wu X, et al. VEGF/VEGFR-Targeted Therapy and Immunotherapy in Non-small Cell Lung Cancer: Targeting the Tumor Microenvironment.Int J Biol Sci. 2022;18:3845–58. [DOI] [PubMed] [PMC]
Qin S, Yi M, Jiao D, Li A, Wu K. Distinct Roles of VEGFA and ANGPT2 in Lung Adenocarcinoma and Squamous Cell Carcinoma.J Cancer. 2020;11:153–67. [DOI] [PubMed] [PMC]
Ferrara N, Gerber H, LeCouter J. The biology of VEGF and its receptors.Nat Med. 2003;9:669–76. [DOI] [PubMed]
Mountzios G, Pentheroudakis G, Carmeliet P. Bevacizumab and micrometastases: revisiting the preclinical and clinical rollercoaster.Pharmacol Ther. 2014;141:117–24. [DOI] [PubMed]
Lauro S, Onesti CE, Righini R, Marchetti P. The use of bevacizumab in non-small cell lung cancer: an update.Anticancer Res. 2014;34:1537–45.Erratum in: Anticancer Res. 2014 Jun;34(6):3232. [PubMed]
Hall RD, Le TM, Haggstrom DE, Gentzler RD. Angiogenesis inhibition as a therapeutic strategy in non-small cell lung cancer (NSCLC).Transl Lung Cancer Res. 2015;4:515–23. [DOI] [PubMed] [PMC]
Yu L, Hu Y, Xu J, Qiao R, Zhong H, Han B, et al. Multi-target angiogenesis inhibitor combined with PD-1 inhibitors may benefit advanced non-small cell lung cancer patients in late line after failure of EGFR-TKI therapy.Int J Cancer. 2023;153:635–43. [DOI] [PubMed]
Rezaee H, Abbasnia S, Alenabi A, Vakili R, Moheghi N, Afshari JT, et al. Expression of Vascular Endothelial Growth Factor A and Its Type 1 Receptor in Supratentorial Neoplasm.Rep Biochem Mol Biol. 2021;10:354–61. [DOI] [PubMed] [PMC]
Watson CJ, Webb NJ, Bottomley MJ, Brenchley PE. Identification of polymorphisms within the vascular endothelial growth factor (VEGF) gene: correlation with variation in VEGF protein production.Cytokine. 2000;12:1232–5. [DOI] [PubMed]
Sambrook J, Fritsch ER, Maniatis T. Molecular Cloning: A Laboratory Manual. 2nd ed. Cold Spring Harbor; 1989.
Liu C, Zhou X, Gao F, Qi Z, Zhang Z, Guo Y. Correlation of genetic polymorphism of vascular endothelial growth factor gene with susceptibility to lung cancer.Cancer Gene Ther. 2015;22:312–6. [DOI] [PubMed]
Liu C, Zhou X, Zhang Z, Guo Y. Correlation of gene polymorphisms of vascular endothelial growth factor with grade and prognosis of lung cancer.BMC Med Genet. 2020;21:86. [DOI] [PubMed] [PMC]
Yang F, Qin Z, Shao C, Liu W, Ma L, Shu Y, et al. Association between VEGF Gene Polymorphisms and the Susceptibility to Lung Cancer: An Updated Meta-Analysis.Biomed Res Int. 2018;2018:9271215. [DOI] [PubMed] [PMC]
Li Y, Liang J, Liu X, Liu H, Yin B, Xiao J, et al. Correlation of polymorphisms of the vascular endothelial growth factor gene and the risk of lung cancer in an ethnic Han group of North China.Exp Ther Med. 2012;3:673–6. [DOI] [PubMed] [PMC]
Naykoo NA, Dil-Afroze, Rasool R, Shah S, Ahangar AG, Bhat IA, et al. Single nucleotide polymorphisms, haplotype association and tumour expression of the vascular endothelial growth factor (VEGF) gene with lung carcinoma.Gene. 2017;608:95–102. [DOI] [PubMed]
Song N, Liu B, Wu J, Zhang R, Duan L, He W, et al. Vascular endothelial growth factor (VEGF) -2578C/A and -460C/T gene polymorphisms and lung cancer risk: a meta-analysis involving 11 case-control studies.Tumour Biol. 2014;35:859–70. [DOI] [PubMed]
Diao L, Yu X, Gao Y, Li Y, Liu H, Liu L, et al. Association of VEGF genetic polymorphisms with the clinical characteristics of non-Hodgkin’s lymphoma.J Cancer Res Clin Oncol. 2009;135:1473–81. [DOI] [PubMed]
El Azzouzi M, El Ahanidi H, Hafidi Alaoui C, Chaoui I, Benbacer L, Tetou M, et al. The Evaluation of Vascular Endothelial Growth Factor A (VEGFA) and VEGFR2 Receptor as Prognostic Biomarkers in Bladder Cancer.Diagnostics (Basel). 2023;13:1471. [DOI] [PubMed] [PMC]
Jaiswal PK, Tripathi N, Shukla A, Mittal RD. Association of single nucleotide polymorphisms in vascular endothelial growth factor gene with bladder cancer risk.Med Oncol. 2013;30:509. [DOI] [PubMed]
Wang Z, Li C, Li X, Shi J, Wu W. Effect of vascular endothelial growth factor rs35569394 in esophageal cancer and response to chemotherapy.Biomol Biomed. 2023;23:271–6. [DOI] [PubMed] [PMC]
Ratnasari N, Nurdjanah S, Sadewa AH, Hakimi M, Yano Y. Difference of polymorphism VEGF-gene rs699947 in Indonesian chronic liver disease population.PLoS One. 2017;12:e0183503. [DOI] [PubMed] [PMC]
Yuan Q, Zuo X, Jia J. Association between promoter polymorphisms of vascular endothelial growth factor gene and sporadic Alzheimer’s disease among Northern Chinese Han.Neurosci Lett. 2009;457:133–6. [DOI] [PubMed]
Ben Wafi S, Kallel A, Ben Fradj MK, Sallemi A, Ben Rhouma S, Ben Halima M, et al. Haplotype-based association of Vascular Endothelial Growth Factor gene polymorphisms with urothelial bladder cancer risk in Tunisian population.J Clin Lab Anal. 2018;32:e22610. [DOI] [PubMed] [PMC]
Jung WY, Min K, Oh YH. Increased VEGF-A in solid type of lung adenocarcinoma reduces the patients’ survival.Sci Rep. 2021;11:1321. [DOI] [PubMed] [PMC]
Bonnesen B, Pappot H, Holmstav J, Skov BG. Vascular endothelial growth factor A and vascular endothelial growth factor receptor 2 expression in non-small cell lung cancer patients: relation to prognosis.Lung Cancer. 2009;66:314–8. [DOI] [PubMed]
Jin Kim Y, Hyun Kim C, Hwan Cheong J, Min Kim J. Relationship between expression of vascular endothelial growth factor and intratumoral hemorrhage in human pituitary adenomas.Tumori. 2011;97:639–46. [DOI] [PubMed]
Ding M, Liu L, Hu C, Liu Y, Qiao Y, Jiang X. Expression of VEGFR2 and NRP-1 in non-small cell lung cancer and their clinical significance.Chin J Cancer Res. 2014;26:669–77. [DOI] [PubMed] [PMC]
Liu G, Chen T, Ding Z, Wang Y, Wei Y, Wei X. Inhibition of FGF-FGFR and VEGF-VEGFR signalling in cancer treatment.Cell Prolif. 2021;54:e13009. [DOI] [PubMed] [PMC]
Zhang S, McCrudden CM, Kwok HF. Prognostic significance of combining VEGFA, FLT1 and KDR mRNA expression in lung cancer.Oncol Lett. 2015;10:1893–901. [DOI] [PubMed] [PMC]
Jain L, Vargo CA, Danesi R, Sissung TM, Price DK, Venzon D, et al. The role of vascular endothelial growth factor SNPs as predictive and prognostic markers for major solid tumors.Mol Cancer Ther. 2009;8:2496–508. [DOI] [PubMed] [PMC]
Lee S, Kang HG, Choi JE, Lee JH, Kang HJ, Baek SA, et al. The Different Effect of VEGF Polymorphisms on the Prognosis of Non-Small Cell Lung Cancer according to Tumor Histology.J Korean Med Sci. 2016;31:1735–41. [DOI] [PubMed] [PMC]
Heist RS, Zhai R, Liu G, Zhou W, Lin X, Su L, et al. VEGF polymorphisms and survival in early-stage non-small-cell lung cancer.J Clin Oncol. 2008;26:856–62. [DOI] [PubMed]
